Health Worlds

Study: Soft Ling Liu Mei Yanlin Hou Lin Jun
Abstract Objective Acanthus on CCl4-induced liver fibrosis in rats of tumor necrosis factor (TNF- ), transforming growth factor 1 (TGF 1) and Smad3 mRNA expression. Methods Wistar rats were randomly divided into 5 groups: control group, model control group, colchicine group, ethanol extract of Acanthus Acanthus low dose group and high dose of ethanol extract. In addition to the control group, the other 4 groups with the CCl4 rat model of liver fibrosis. Colchicine group, ethanol extract of Acanthus Acanthus low dose group and high dose of ethanol extract after 4 weeks were given medicines, the control group received saline, 1 / d. Rats were killed after 8 weeks, RT-PCR detection of liver TNF- , TGF 1 and Smad3 mRNA expression. Results Compared with the control group, model control group TNF- , TGF 1 and Smad3 mRNA expression increased (0.23 0.18vs0.49 0.28,0.29 0.16vs1.79 2.13, 0.52 0.36vs0.99 0.53, P 0.05). Conclusion Acanthus can inhibit hepatic fibrosis liver tissue TNF- , TGF 1 and Smad3mRNA expression.
Key words liver tumor necrosis factor Acanthus transforming growth factor 1 Smad3
Acanthus Acanthus ilicifolius Linnseus is a growth area in the tropical coastal mangrove plants, is Acanthaceae (Acanthaceae) is Acanthus Acanthus. Acanthus included in the "National Chinese herbal medicine", the whole plant or root medicine, with heat and detoxifying, reducing swelling, the effectiveness of cough and


asthma, attending lymph nodes, acute and chronic hepatitis, liver and spleen enlargement, stomach pain, cough, asthma [1].

The formation mechanism of liver fibrosis extracellular matrix (ECM) synthesis and degradation disorders. Tumor necrosis factor (TNF- ) in the activation of hepatic fibrosis and initiating an important role in the regulation; transforming growth factor 1 (TGF 1) is leading to liver fibrosis, the most important cytokines play its role and intracellular signal transduction protein Smad closely related. Which, Smad3 is mediated by TGF 1 induced liver fibrosis in the key molecules. The experimental observation of Acanthus rat experimental liver fibrosis treatment efficacy of rat liver tissue TNF- , TGF 1 and Smad3 mRNA expression, of Acanthus on liver fibrosis mechanisms.
1 Materials
1.1 Animals Wistar 60 rats of clean grade, weight (180 20) g, by the Experimental Animal Center of Guangxi Medical University.
1.2 Drugs and alcohol extract of Acanthus prepared by the extraction of the experimental group subjects. Acanthus take 100 g of ethanol extract, prepared with distilled water into a single high dose concentration of 0.2 g (equivalent to raw herbs 46.60 g) · ml-1 of the liquid; take 50 g of ethanol extract of Acanthus, with single distilled water preparation of low-dose concentration of 0.1 g · ml-1 of the liquid. -4 save standby, Shake well before use; colchicine (Xishuangbanna shares Pharmaceutical Co., Ltd., batch number: 060717), with a single concentration of distilled water for the preparation of 0.040 mg · ml-1 of the liquid.
Carbon tetrachloride 1.3 reagents (Shanghai Chemical Reagent Company, batch number 20050393). Trizol total RNA extraction kit (United States Invitrogen); RT-PCR reverse transcriptase kit (United States Fermentas); anhydrous ethanol (Chengdu Kelong Chemical Reagent Factory, batch number 20070126); chloroform (Chongqing Yangtze River Chemical Reagent Factory, batch number 20070507), isopropanol (Chengdu Kelong Chemical Reagent Factory, batch number 20070418).
2 Methods
2.1 rat model of liver fibrosis [2] and administration methods 60 Wistar rats were randomly divided into 5 groups: control group, model control group, colchicine group, ethanol extract of Acanthus Acanthus high-dose group and low dose of ethanol extract. 12 in each group. In addition to the control group, the rest of the group 1st subcutaneously 40? L4 vegetable oil solution of 0.05 ml · kg-1, 2 times a week after the subcutaneous injection of 40? L4 vegetable oil solution of 0.03 ml · kg-1. Subcutaneous injection of the control group, only an equal volume of vegetable oil. For 8 weeks. After 4 weeks of the injection of carbon tetrachloride and colchicine group was 0.4 mg · kg-1, ethanol extract of Acanthus high and low dose group, respectively 2.0,1.0 g · kg-1, with equal volume of drug delivery method by 10 ml · kg-1 orally, 1 time / d. Control group and model control group received saline. For 4 weeks.
2.2 samples were collected 8 weeks all rats were killed, one left lobe of liver tissue, stored at -70 .
2.3 The liver tissue TNF- , TGF 1 and Smad3 mRNA expression in rat liver measured Trizol extraction of total RNA, methods operate according to kit instructions, RNA purity by UV spectrophotometer, by RT-PCR shows the mRNA reverse transcription kit RT into cDNA. RT-PCR analysis of TNF- , TGF 1 and Smad-actin as internal control. TNF- , TGF 1, Smad3, and -actin primers were synthesized by Shanghai Biological Engineering Technology Health Engineering Services Limited synthesis. TNF- primer sequences: 5'TGCCTCAGCCTCTTCTCATT 3 ', downstream primer sequence: 5'TGGTATGAAGTGGCAAATCG 3', amplification product length is 404bp; TGF 1 upstream primers: 5'TACAGGGCTTTCGCTTCAGT 3 ', downstream primer sequence: 5'TGGTTGTAGAGGGCAAGGAC 3' PCR product length is 394bp; Smad3 upstream primers: 5'GCAGTGGCAATCACAGAGAA 3 ', downstream primer sequence: 5'AACAGCCTGGGAGAGACTCA 3', amplification product length is 386bp; -actin upstream primer sequences: 5'AACCCTAAGGCCAACCGTGAAAAG 3 ', downstream primers: 5'TCATGAGGTAGTCTGTCAGGT 3 ', amplification product length is 240bp. 5 g of total RNA obtained by reverse transcription kit instructions reversed into cDNA. The cDNA as a template PCR reactions were amplified by the following conditions TNF , TGF 1 and Smad3 fragments. TNF- PCR conditions: 94 4min 30s, 94 30s, 52 30s, 72 1 min, 30 cycles, 72 8 min; TGF 1 PCR conditions: 94 4 min 30 s, 94 30 s, 55 30 s, 72 1 min, 30 cycles, 72 8 min; Smad3 PCR conditions: 94 4 min30 s, 94 30 s, 53 30 s, 72 1 min, 30 cycles, 72 8 min. 5 l PCR products were obtained in 2% agarose gel (containing ethidium bromide) on the electrophoresis, electrophoresis conditions: 120V, 20min, gel electrophoresis image analysis system acquires images. The internal reference -actin as a benchmark for the semi-quantitative analysis to gene amplification zone of the gray value and the internal reference -actin zone of the gray value of the ratio of target gene amplification to determine the relative expression level.
2.4 Statistical Methods SPSS13.0 software analysis, measurement data with s, multiple analysis of variance of the mean. P <0.05 indicated significant difference.
3 Results
3.1 Extraction of liver total RNA extracted total RNA by measuring OD260/OD280 ratios ranging from 1.7 to 2.0, indicating that the purity of the RNA samples meet the test requirements. 1% agarose gel electrophoresis by UV light observation, no significant degradation of RNA. Links in the paper for Union


Friends Links:Automation Control Blog
Automation Products Order Numbers