7
Mar
Study: Soft Ling Liu Mei Yanlin Hou Lin Jun
Abstract Objective Acanthus on CCl4-induced liver fibrosis in rats of tumor necrosis factor (TNF- ), transforming growth factor 1 (TGF 1) and Smad3 mRNA expression. Methods Wistar rats were randomly divided into 5 groups: control group, model control group, colchicine group, ethanol extract of Acanthus Acanthus low dose group and high dose of ethanol extract. In addition to the control group, the other 4 groups with the CCl4 rat model of liver fibrosis. Colchicine group, ethanol extract of Acanthus Acanthus low dose group and high dose of ethanol extract after 4 weeks were given medicines, the control group received saline, 1 / d. Rats were killed after 8 weeks, RT-PCR detection of liver TNF- , TGF 1 and Smad3 mRNA expression. Results Compared with the control group, model control group TNF- , TGF 1 and Smad3 mRNA expression increased (0.23 0.18vs0.49 0.28,0.29 0.16vs1.79 2.13, 0.52 0.36vs0.99 0.53, P 0.05). Conclusion Acanthus can inhibit hepatic fibrosis liver tissue TNF- , TGF 1 and Smad3mRNA expression.
Key words liver tumor necrosis factor Acanthus transforming growth factor 1 Smad3
Acanthus Acanthus ilicifolius Linnseus is a growth area in the tropical coastal mangrove plants, is Acanthaceae (Acanthaceae) is Acanthus Acanthus. Acanthus included in the "National Chinese herbal medicine", the whole plant or root medicine, with heat and detoxifying, reducing swelling, the effectiveness of cough and

asthma, attending lymph nodes, acute and chronic hepatitis, liver and spleen enlargement, stomach pain, cough, asthma [1].
The formation mechanism of liver fibrosis extracellular matrix (ECM) synthesis and degradation disorders. Tumor necrosis factor (TNF- ) in the activation of hepatic fibrosis and initiating an important role in the regulation; transforming growth factor 1 (TGF 1) is leading to liver fibrosis, the most important cytokines play its role and intracellular signal transduction protein Smad closely related. Which, Smad3 is mediated by TGF 1 induced liver fibrosis in the key molecules. The experimental observation of Acanthus rat experimental liver fibrosis treatment efficacy of rat liver tissue TNF- , TGF 1 and Smad3 mRNA expression, of Acanthus on liver fibrosis mechanisms.
1 Materials
1.1 Animals Wistar 60 rats of clean grade, weight (180 20) g, by the Experimental Animal Center of Guangxi Medical University.
1.2 Drugs and alcohol extract of Acanthus prepared by the extraction of the experimental group subjects. Acanthus take 100 g of ethanol extract, prepared with distilled water into a single high dose concentration of 0.2 g (equivalent to raw herbs 46.60 g) · ml-1 of the liquid; take 50 g of ethanol extract of Acanthus, with
Carbon tetrachloride 1.3 reagents (Shanghai Chemical Reagent Company, batch number 20050393). Trizol total RNA extraction kit (United States Invitrogen); RT-PCR reverse transcriptase kit (United States Fermentas); anhydrous ethanol (Chengdu Kelong Chemical Reagent Factory, batch number 20070126); chloroform (Chongqing Yangtze River Chemical Reagent Factory, batch number 20070507), isopropanol (Chengdu Kelong Chemical Reagent Factory, batch number 20070418).
2 Methods
2.1 rat model of liver fibrosis [2] and administration methods 60 Wistar rats were randomly divided into 5 groups: control group, model control group, colchicine group, ethanol extract of Acanthus Acanthus high-dose group and low dose of ethanol extract. 12 in each group. In addition to the control group, the rest of the group 1st subcutaneously 40? L4 vegetable oil solution of 0.05 ml · kg-1, 2 times a week after the subcutaneous injection of 40? L4 vegetable oil solution of 0.03 ml · kg-1. Subcutaneous injection of the control group, only an equal volume of vegetable oil. For 8 weeks. After 4 weeks of the injection of carbon tetrachloride and colchicine group was 0.4 mg · kg-1, ethanol extract of Acanthus high and low dose group, respectively 2.0,1.0 g · kg-1, with equal volume of drug delivery method by 10 ml · kg-1 orally, 1 time / d. Control group and model control group received saline. For 4 weeks.
2.2 samples were collected 8 weeks all rats were killed, one left lobe of liver tissue, stored at -70 .
2.3 The liver tissue TNF- , TGF 1 and Smad3 mRNA expression in rat liver measured Trizol extraction of total RNA, methods operate according to kit instructions, RNA purity by UV spectrophotometer, by RT-PCR shows the mRNA reverse transcription kit RT into cDNA. RT-PCR analysis of TNF- , TGF 1 and Smad-actin as internal control. TNF- , TGF 1, Smad3, and -actin primers were synthesized by Shanghai Biological Engineering Technology Health Engineering Services Limited synthesis. TNF- primer sequences: 5'TGCCTCAGCCTCTTCTCATT 3 ', downstream primer sequence: 5'TGGTATGAAGTGGCAAATCG 3', amplification product length is 404bp; TGF 1 upstream primers: 5'TACAGGGCTTTCGCTTCAGT 3 ', downstream primer sequence: 5'TGGTTGTAGAGGGCAAGGAC 3' PCR product length is 394bp; Smad3 upstream primers: 5'GCAGTGGCAATCACAGAGAA 3 ', downstream primer sequence: 5'AACAGCCTGGGAGAGACTCA 3', amplification product length is 386bp; -actin upstream primer sequences: 5'AACCCTAAGGCCAACCGTGAAAAG 3 ', downstream primers: 5'TCATGAGGTAGTCTGTCAGGT 3 ', amplification product length is 240bp. 5 g of total RNA obtained by reverse transcription kit instructions reversed into cDNA. The cDNA as a template PCR reactions were amplified by the following conditions TNF , TGF 1 and Smad3 fragments. TNF- PCR conditions: 94 4min 30s, 94 30s, 52 30s, 72 1 min, 30 cycles, 72 8 min; TGF 1 PCR conditions: 94 4 min 30 s, 94 30 s, 55 30 s, 72 1 min, 30 cycles, 72 8 min; Smad3 PCR conditions: 94 4 min30 s, 94 30 s, 53 30
2.4 Statistical Methods SPSS13.0 software analysis, measurement data with s, multiple analysis of variance of the mean. P <0.05 indicated significant difference.
3 Results
3.1 Extraction of liver total RNA extracted total RNA by measuring OD260/OD280 ratios ranging from 1.7 to 2.0, indicating that the purity of the RNA samples meet the test requirements. 1% agarose gel electrophoresis by UV light observation, no significant degradation of RNA. Links in the paper for Union
Pauline
2011/08/28 20:57
1.4 production and uses most of the carbon tetrachloride produced is used in the . such as vitamin e, reduce the hepatotoxic action of carbon tetrachloride.
Den
2011/08/29 10:16
carbon tetrachloride (hsg 108, 1998)
Armstrong
2011/08/29 22:55
cci4 has long served as a model compound for study of hepatotoxicity.
Victoria
2011/09/04 09:36
mechanisms of carbon tetrachloride hepatotoxicity.
Katherleen
2011/09/15 11:28
hepatoprotective activity of camellia sinensis and its possible mechanism of action . liver from carbon-tetrachloride-induced damage. probable mechanism of its action may be .
Solomon
2011/09/22 06:27
ijpt vol 7, no 1, (2008)
May
2011/09/28 05:28
darcy naturals is a one stop place for all your herbal products. of glycyrrhiza as the central mechanism contributing to its protective action against carbon tetrachloride .
Ingemar
2011/09/28 23:01
herbal products and remedies at darcy naturals
Leopold
2011/10/11 07:46
hepatoxicity and mechanism of action of haloalkanes: carbon tetrachloride as at - abstract: the use of many halogenated alkanes such as carbon tetrachlo .
Megan
2011/10/15 21:17
hepatoxicity and mechanism of action of haloalkanes: carbon .
Lucia
2011/10/20 02:05
. of tween 80. carbon tetrachloride was given 2 hours of the last dose. carbon tetrachloride-mediated liver injury exert their protective action by .
Norton
2011/11/24 18:44
bioline international official site (site up-dated regularly)
Reuben
2011/12/07 20:29
effect of carbon tetrachloride on mechanism of liver glycogen in the rat. the effect of carbon tetrachloride on albumin synthesis in rat with alcoholic liver .
Giselle
2011/12/09 03:53
evaluation of protective role of thiola against carbon .
Gladys
2011/12/21 20:48
taking together, camellia sinensis protectes the liver from carbon-tetrachloride-induced damage. probable mechanism of its action may be due to its .
Albert
2012/01/02 22:54
indexing metadata - reading tools
Elvira
2012/01/03 19:39
hepatoxicity and mechanism of action of haloalkanes: carbon tetrachloride as a toxicological model (critical reviews in toxicology) .
Allen
2012/01/16 07:28
carbon tetrachloride — infoplease.com
Evangeline
2012/01/21 12:57
possible mechanism of adenosine protection in carbon tetrachloride acute hepatotoxicity. searching for the mechanism of action, we found that adenosine .
Trista
2012/01/21 21:43
possible mechanism of adenosine protection in carbon .
Wendell
2012/01/22 15:04
although the mechanism of liver injury by clofibrate and carbon tetrachloride is different, both of them can induce liver injury, which is a signal .
Elliot
2012/02/09 23:21
world j gastroenterol
Vicky
2012/02/14 08:10
nature 209, 36 - 40 (01 january 1966); doi:10.1038/209036a0. necrogenic action of carbon tetrachloride in the rat: a speculative mechanism based on activation .
Muriel
2012/02/15 18:39
necrogenic action of carbon tetrachloride in the rat: a .
Blanche
2012/02/18 19:47
action of air. the vapors of carbon disulphide are highly inflammable . carbon disulphide reacts with chlorine to give carbon tetrachloride and sulphur .
Fiona
2012/02/20 05:26
sulphides of carbon | tutorvista
Barnett
2012/02/20 11:53
the mechanism of this protective effect of liv.52 remains to be elucidated, but we are . effect against the hepatotoxic action of carbon tetrachloride in .
Jefferyjeffery
2012/02/25 00:15
protection by indigenous drugs against hepatotoxic effects of .
Robinson
2012/02/25 02:41
sections: air pollutants, carbon monoxide, mechanism of action, clinical effects, . dioxide, mechanism of action, clinical effects & treatment, nitrogen oxides, mechanism of .
Cathy
2012/03/07 08:46
accesspharmacy | specific chemicals
Angelo
2012/03/10 03:56
. of trevor's colleagues, to unravel the mechanism of the action of carbon tetrachloride, a well documented . in the case of carbon tetrachloride and other halocarbons, peroxyl .
Ira
2012/03/10 11:58
trevor frank slater 1931 - 1992
Elliott
2012/03/12 04:46
carbon tetrachloride. first draft prepared by ms j. de fouw, national institute of public . action in the six programme areas of chapter 19, agenda 21, all lend .
Godfery
2012/03/13 08:44
carbon tetrachloride
Lorraine
2012/03/25 13:14
the results support the hypothesis that carbon tetrachloride-induced lipid peroxidation is not the only mechanism of its toxic action.
Lauren
2012/03/28 16:09
carbon tetrachloride (ehc 208, 1999)
Virginia
2012/04/10 03:39
of the production and consumption of carbon tetrachloride, manufacture has . genotoxic mechanism (ipcs, 1999), and it was considered acceptable to .
Fred
2012/04/13 02:10
carbon tetrachloride in drinking-water
Ashbur
2012/04/21 23:40
11 jul 2007 . weber lw, boll m, stampfl a. hepatotoxicity and mechanism of action of haloalkanes: carbon tetrachloride as a toxicological model.
Hogan
2012/05/02 23:04
drugs and poisons: carbon tetrachloride - the sweet smell of .
Karen
2012/05/02 23:04
of metabolic conversion of carbon tetrachloride. by rat liver . carbon tetrachloride on rat liver microsomes during the first hour of poisoning in vivo.
Astrid
2012/05/11 20:37
slater t f. necroaenic action or carbon letrachloride in the .
Mignon
2012/05/14 15:21
the production of phosgene was observed when a pure carbon tetrachloride molecular beam . in front of the sample, which is intended to act as an inert surface.
Friends Links:Automation Control Blog
Automation Products Order Numbers



high blood pressure and kidney damage
auto immune hemolytic anemia