11 Jan

in patients with dilated cardiomyopathy 晴

17:26 , Via Original Large | Medium | Small

ppt myocardial ischemia and reperfusion injury in heat: doc clinical-99mTc-MIBI myocardial perfusion with dipyridamole significantly . heat: ppt myocardial ischemia and ischemia / reperfusion injury in heat: doc myocardial eNOS expression and NO changes on the diabetic . heat: ppt definition of myocardial infarction, diagnosis and evaluation of heat: pdf thermal imaging system for early diagnosis of myocardial ischemia . heat: doc Sini decoction on myocardial ischemia in heat: pdf Heart Medical Papers surgical myocardial ischemia . heat: doc Angelica sinensis pretreatment on myocardial ischemia-reperfusion damage . heat: doc Medicine - Ginkgo biloba extract on myocardial ischemia reperfusion injury . heat: doc Thesis - EA "in customs," "God the door" . pretreatment on acute heat: pdf doctoral thesis - ginsenoside Rb1 on myocardial ischemia-reperfusion . heat: txt Medicine study - Cardiac radionuclide was as in the diagnosis and treatment of coronary heart disease . heat: doc99mTcMIBI evaluation of myocardial perfusion imaging after acute myocardial infarction . heat: doc ECG myocardial ischemia in heat: pdf secure injection of anti-ischemic effects and mechanisms of heat: doc Clinical Medicine - Effect of pravastatin on myocardial ischemia in of the clinical efficacy of . heat: ppt myocardial perfusion imaging heat: txt heat Treatment progress of coronary heart disease: doc2004 annual results of statistical heat: pdf hemodilution on myocardial ischemia reperfusion arrhy

in patients with dilated cardiomyopathy

thmias . heat: doc Angelica injection on myocardial ischemia reperfusion injury P5 . heat: ppt myocardial infarction heat: pdf2009 Outline 22 medical professional practice of nuclear medicine _ heat: ppt diagnosis of myocardial bridge heat treatment: doc What is angina heat: ppt "Neiguan" point injection on myocardial ischemia in heat: ppt EA "in customs," "to positive" effect on myocardial ischemia. heat: doc Clinic - Xuesaitong clinical observation of improvement of myocardial ischemia in heat: ppt double valve replacement and myocardial protection of assisted circulation of the heat:
Dilated cardiomyopathy (IDC), is a serious heart disease, so far, the cause of dilated cardiomyopathy and pathogenesis is still unclear, many studies found that patients with dilated cardiomyopathy have a family history of genetic tendency, and its incidence and immune imbalance. Particularly severe dilated cardiomyopathy, protraction, causing great harm, as early diagnosis and symptomatic treatment is particularly important. The present study indicate that the pathogenesis of dilated cardiomyopathy genetic abnormalities may be the primary immune mechanisms of dilated cardiomyopathy may be an autoimmune disease. Interferon (IFN-r) in the body's inflammatory immune response and play an importa
nt role in the process may be related to the occurrence of dilated cardiomyopathy is closely related to the development and pathological processes.
Many studies have found that interferon in the body's inflammatory immune response and play an important role in the process may be related to the occurrence of dilated cardiomyopathy is closely related to the development and pathological processes. Interferon is interferon gene expression product, the gene has the polymorphism 874 points (SNP), and interferon 874T is a product of the high expression of phenotype, interferon gene 874 point type and the expression of interferon disease susceptibility. Interferon is not currently see with the genotype associated with dilated cardiomyopathy reported. We examined the interferon gene polymorphism 874 changes to interferon immune and genetic factors of dilated cardiomyopathy in the pathogenesis of the possible role and clinical significance.1, the subjects
Total patients with dilated cardiomyopathy 3l patients (by history, physical examination, the physical diagnosis and histopathological diagnosis, etc.), diagnosis of dilated cardiomyopathy cases in 1980, according to the criteria established by the World Health Organization in all cases of cadres from the provincial clinics and nursing homes Screening hospital patients identified, are in unrelated Han individuals in the north, l9 male, female l2 cases, 35 cases of normal control group, both the North Han, unrelated healthy blood donors, blood sampling all subjects 5ml, EDTA anticoagulant.
2.DNA blood extraction mining 5ml, 5% EDTA anticoagulant, using the method described Res.se extract genomic DNA.Detection of interferon gene promoter primers were 874 Lai Mude Biotechnology Co., Ltd. from the United States to provide, based on a pair of specific primers terminated primers: P1: 5 for a GTGGAGGCTGAACCCCGTCCT a 3: P2: 5 a 3 a GTGGAGGCTGAACCCCGTCCT interferon promoter Gene 874 points and the specificity of gene coding sequence in Table Table 1 interferon gene of 874 points of type polymorphismApplication of the United States produced by PCR Instrument PE (4800) and related reagents, PCR reaction volume in 50 l, 94 denaturation 5min, then 94 , 30s; 60 annealing, 50s; 72 extension, 40s; a total of 30 cycles, extension stimulation were characterized by conventional gel electrophoresis in 2% agarose ,15-20min, UV light observation.
5. Application of SPSS statistical analysis system software.1. Standard interferon DNAPCR-SSP typing results of standard interferon DNA typing, see the 250bp fragment and with a positive band appears to be positive in the control. This article uses the kit to detect interferon template DNA positive, the results of each sample were banding, suggesting that the gene fragment amplification is required for success, shown in Figure
2. Interferon DNA samples, PCR-SSP typing results, type of interferon gene polymorphism in normal populations and dilated cardiomyopathy in the distribution in Table Dilated cardiomyopathy interferon 874T allele frequency was significantly higher than PInterferon (IFN-r) is a low molecular weight glycoprotein, is one of important cytokines, mainly by lymphocytes, monocytes and macrophages released and involved in human inflammatory and immune response. Synthesis and synthesis of interferon is controlled by genes. The synthesis of individual differences, and some can be a difference of more than a few times. The main reason may be differences in cytokine gene regulatory regions or the promoter region polymorphism. In vitro tests showed that the cells were stimulated independent of each cytokine secretion vary greatly. In addition, a synthesis of some of interferon, whereas the other is low the synthesis of interferon, this difference is not the result of regulating the immune system, but the interferon variant genotype polymorphism. Individual differences in the synthesis of interferon great now that the TNF gene promoter region or regulatory regions of different alleles can also be said that direct control of the polymorphisms of interferon synthesis.
According to genotype and serum cytokine levels of cytokines in the clinical relationship between the synthesis of cytokines have been divided into high, medium and low indicators and use of three different cytokine levels and clinical disease. Has been proved that many diseases and pathological processes related to the corresponding cytokines. Interferon is an important human cytokines. In autoimmune diseases, play an important role. Polymorphic interferon, interferon gene polymorphism upstream of 874 point mutation, the first 874 points from A into T base due. According to genotype and serum cytokine levels of cytokines in the clinical relationship between the synthesis of cytokines have been divided into high, medium and low indicators and use of three different cytokine levels and clinical disease. Has been proved that many diseases and pathological processes related to the corresponding cytokines. Interferon is an important human cytokines. In autoimmune diseases, play an important role. The results showed dilated cardiomyopathy interferon (874T) allele frequency was 32.26%, while the control group was 11.43%, dilated cardiomyopath
y interferon (874T)) allele frequency was significantly higher than control group, compared with the normal healthy group, P
Our study further elucidate the pathogenesis of dilated cardiomyopathy mechanism for the clinical treatment of disease prevention and control of the disease and provide a theoretical foundation based on response. In addition, the study of other autoimmune diseases provides useful clues. This study shows from one side of interferon (874T) of the genotype variability of dilated cardiomyopathy play an important role, suggesting that: when a person of interferon (874) gene is a T, on the susceptibility to dilated cardiomyopathy , and its interferon (874T) secretion is also high, indicating that interferon (874T) locus genotype can be used as dilated cardiomyopathy to determine susceptibility and disease indicators. For interferon (874T) mutation sites, and individual susceptibility and pathogenesis of dilated cardiomyopathy causal relationship needs further study.
Novia
2011/08/29 20:23
in the united states, the most common cause of dilated cardiomyopathy is extensive . this may make heart failure that comes with dilated cardiomyopathy worse.
Fionn
2011/09/01 14:40
cardiomyopathy
Solomon
2011/09/05 16:14
patients with cardiomyopathy will most commonly have a heart with normal anatomy. hypertrophic cardiomyopathy presents in a variety of ways.
Roger
2011/09/08 20:39
cardiomyopathy, cincinnati children's hospital medical center
Avivahc
2011/10/24 08:20
determinants of left ventricular untwisting behaviour in patients with dilated cardiomyopathy: analysis by two-dimensional speckle tracking .
Ignace
2011/10/28 02:49
determinants of left ventricular untwisting behaviour in .
Cara
2011/10/28 08:51
beneficial effects of pentoxifylline in patients with idiopathic dilated cardiomyopathy treated with angiotensin-converting enzyme inhibitors and carvedilol .
Hyman
2011/10/30 00:54
beneficial effects of pentoxifylline in patients with .
Norma
2011/11/02 13:00
background:the prognosis of patients with dilated cardiomyopathy remains poor. 3) dhm was significantly lower in patients with nyha functional class 3, 4 than .
Brandon
2011/11/23 07:34
abstract
Meredith
2011/12/02 21:33
mutations in cypher/zasp in patients with dilated cardiomyopathy and left ventricular non-compaction . in addition, inlvm with a hypertrophic dilated left ventricle, .
Harvey
2011/12/06 13:24
mutations in cypher/zasp in patients with dilated .
Basil
2011/12/10 10:23
and a heart with dcm are shown in figure 1a and figure 1b. in recent promising studies in adult patients with dilated cardiomyopathy, a special pacemaker that can pace .
Henary
2011/12/11 15:02
dilated cardiomyopathy
Randy
2011/12/15 17:55
mundhenke, m; schwartzkopff, b; k?stering, m; deska, u; klein, r m; strauer, b e . and coronary circulation in patients with mild dilated cardiomyopathy .
Gill
2011/12/16 10:00
endogenous plasma endothelin concentrations and coronary .
Clifford
2011/12/25 22:02
dilated cardiomyopathy occurs most often in middle-aged people and more often in men than women. some patients with dilated cardiomyopathy die awaiting a transplant .
Barlow
2012/01/06 21:00
cardiomyopathy - causes, symptoms & treatment
Emmanuel
2012/01/10 09:18
overview: definition dilated cardiomyopathy (dcm) denotes global left ventricular systolic dysfunction in the absence of hypertension, valve disease, or significant .
Estelle
2012/01/21 00:48
dilated cardiomyopathy: emedicine pathology
Dennis
2012/01/27 18:16
there are three main types of cardiomyopathy: dilated, hypertrophic and restrictive. in these young patients the heart condition is often associated with changes in the .
Morgan
2012/02/05 11:20
american heart association: cardiomyopathy
Judith
2012/02/16 17:58
[serum digoxin level in patients with dilated cardiomyopathy] . in 77 patients (63 male, 14 female) with invasively verified idc serum-digoxin levels .
Sandy
2012/02/22 01:33
dilated cardiomyopathy - wikipedia, the free encyclopedia
Kerr
2012/02/23 07:55
overview: the world health organization (who) defines dilated cardiomyopathy as a condition in which the ventricular chambers exhibit increased diastolic and systolic .
Abner
2012/03/06 01:05
cardiomyopathy, dilated: emedicine radiology
Cora
2012/03/19 21:05
objectives: the purpose of this study was to assess regional coronary flow and contractile reserve in patients with idiopathic dilated cardiomyopathy (idcm) .
Marjorie
2012/03/24 23:39
regional coronary flow and contractile reserve in patients .
Penelope
2012/04/15 05:03
contraction function of the left ventricle in patients with dilated cardiomyopathy: comparison of delayed enhanced mr imaging and indine -123- metaiodobenzylguanidine .
Aldrich
2012/04/24 04:18
naosite: contraction function of the left ventricle in patients .
Ian
2012/04/24 08:48
for patients with ischemic cardiomyopathy, the underlying cause of their cardiomyopathy, coronary artery . by about 30-35 percent in patients with dilated cardiomyopathy.
Jim
2012/04/28 04:15
cardiomyopathy treatment - us news and world report
Valentine
2012/04/28 21:35
clinical evaluation of the corcap cardiac support device in. patients with dilated cardiomyopathy . trial enrolled 300 patients with nyha class iii-iv hf and dilated .
Rebecca
2012/05/01 23:36
clinical evaluation of the corcap cardiac support device in .
Brian
2012/05/02 11:15
dilated cardiomyopathy is myocardial dysfunction producing heart failure in which . in some patients, dcm is believed to start with acute myocarditis .
Cassiecatherine
2012/05/02 23:11
dilated cardiomyopathy: cardiomyopathies: merck manual .
Brendan
2012/05/10 19:14
anti-mitochondrial antibodies in patients with dilated cardiomyopathy (anti-m7) are directed against flavoenzymes with covalently bound fad .
Gregary
2012/05/16 00:23
anti-mitochondrial antibodies in patients with dilated .



Friends Links:Automation Control Blog
Automation Products Order Numbers
  1. Categories
  2. Default
Add a comment

Nickname

Site URI

Email

:
Enable HTML Enable UBB Enable Emots Hidden Remember [Login] [Register]