Health Worlds

Immediately to the health of community participation in popular discussion
Acquired human immunodeficiency virus type within the capsid protein p24 expression in E. coli and purification
Journal of Experimental and Clinical Virology 1999, Volume 13 No. 4 Presentation
Study: Zeng Yi Wang Zichun
Unit: 100052 Beijing, China Academy of Preventive Medicine, Institute of Virology
Human acquired immunodeficiency syndrome (Acquired Immunodeficiency Syndrome, AIDS) referred to as AIDS, is by the human immunodeficiency virus (Human Immunodeficiency Virus, HIV) induced [1,2], based on genetic and serological characteristics, HIV can be divided into for the HIV-1 and HIV-2, the former infections around the world, the latter mainly confined to parts of Africa [3]. HIV genome consists of 9500 nucleotides, in its long terminal repeat sequences at both ends (LTRs). HIV has nine open ing frames, gag gene encoding the viral capsid protein, translation, first into a 55 kD precursor protein (p55), then the role of HIV protease cleavage into p17, p24, p15 three proteins. HIV p24 and p17, respectively, constitute the inner shell and the membrane particles, p15 further cracking and virus RNA binding nucleocapsid protein p9, and p7 [4 ~ 6]. Early in HIV infection can produce antibodies against the p24, and with the progression, p24 antibody titers decreased [7], as p24 and the membrane glycoprotein (for HIV-1, gp160 outside the degradation of precursors membrane protein gp120 an


d transmembrane protein gp41; for HIV-2, gp140 degradation products of gp105 and gp36) can be used to determine the HIV infection, HIV diagnostic kits is an important part. In addition, p24 has been used to inhibit the virus particle as the packaging specificity of the antiviral target [8]. In order to obtain a large number of high-purity p24 protein, we used E. coli expression vector to express p24 protein, and immobilized metal ions (Ni2) ligand affinity chromatography from the soluble protein expression in bacteria and purified protein, the HIV Development of diagnostic reagents has laid a good foundation.
1 Materials and methods
1.1 Strains and plasmids E. coli BL21 (DE3) [9], the chromosome with phage T7 RNA polymerase gene, the for the pET expression vector. Full-length gene containing HIV-1HXB2 room saved by this plasmid.
1.2 Enzymes and reagents pGEM-T vector, PCR purification system purchased from Promega Corporation, restriction enzymes, the standard DNA, the molecular weight and the Taq DNA polymerase were purchased from TaKaRa. T4 DNA ligase were purchased from GIBCO BRL Company. Ni2 ion affinity chromatography packing purchased from Pharmacia Biotech companies. HIV positive serum stored in our laboratory.
1.3 p24 gene cloning and expression vector according to HXB2 strain gene sequences, a pair of primers. Primer 1:5 'GGCATATGCAAGGGCAAATGGT
ACA3 'and primer 2:5' 3 '. Amplification conditions were: 94 2 min, 94 1 min, 60 2 min, 72 2 min, 35 cycles, 72 15 min end of the amplification. PCR products were purified using Promega recovery of the company's Wizard PCR purification kit. PCR products were purified with the pGEM-T vector connecting through AT complementary sticky end (see the specific operating instructions), selected by blue-white colony screening positive clones pGEM-p24, the recombinant plasmid by PCR, restriction enzyme digestion and sequencing methods identification. Identification of the correct plasmid DNA and expression vector pET22b with Nde and also Xho were digested with low melting point plastic carrier and p24 gene fragments recovered by T4 DNA ligase to construct the expression plasmid pET-p24. Transformed into E. coli BL21 (DE3) were obtained after the expression of p24 protein in bacteria.
1.4 Recombinant protein expression and purification of soluble proteins to pick a single pET-p24/BL21 (DE3) clones were inoculated into 5 ml containing 100 g / ml ampicillin LB medium, 37 overnight shaking shaking. 1:100 inoculated the next day to the same medium in 500 ml, 37 A600 absorbance values of the growth to the broth reached 0.4 ~ 0.6, the final concentration of 1 mmol / L of IPTG, induced by 4 hr and centrifuged to harvest bacteria body. -20 cryopreservation. Weight hanging amount of ultrasonic strain buffer (composition: 50 mmol / L Tris. HCl, pH7.9, 1 mmol / L EDTA, 1 mmol / L DTT, 0.1% Triton X-100) under ice bath, sonicated bacteria (each 30 seconds, a total of 10 times. 4 12 000 r / min centrifugation 20 min, supernatant was collected. and then by 4 18 000 r / min 30 min centrifugation the supernatant. precipitation with the right amount of washing liquid (composed of : 50 mmol / L Tris. HCl pH7.9, 1 mmol / L EDTA, 0.1% Triton X-100, 2 mmol / L Urea) washed overnight, 12 000 r / min 20 min centrifugation supernatant was collected. supernatant was directly through affinity chromatography (column packing for the Ni-BTA Agarose), eluted with a balanced solution to the baseline level, then the balance with different concentrations of imidazole elution, collecting different elution peak, with 12% SDS-PAGE and Coomassie brilliant blue staining, protein electrophoresis after conclusion of the transfer to nitrocellulose membrane, using Western-blot detection of the antigen. with one anti-HIV-1 antibody for the serum to 1:100 dilution. one, two anti- role after diaminobenzidine and 0.01% H2O2 solution, the color reaction, to be specific protein bands appeared, the reaction was stopped with distilled water.
2 Results
2.1 HIV-1 p24 gene cloning and expression vector for HIV-1 HXB2 cDNA as a template, using PCR to amplify p24 gene, primers 5 'Nde restriction site added (including the start codon ATG), In the 3 'end of Xho restriction site added, PCR product sizes consistent with the expected 638 bp (Figure 1). PCR products were purified, the complementary sticky end by AT T4 DNA ligase with the pGEM-T vector and transformed into host strain DH5 , colonies selected by blue, white positive clones selected in order to facilitate the operation and sequencing DNA digestion, The recombinant plasmid pGE
[3] Next


Friends Links:Automation Control Blog
Automation Products Order Numbers